95
|
New England Biolabs
α 2 3 neuraminidase α 2 3 Neuraminidase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/%CE%B12-3+Neuraminidase+S/pmc04325708-85-18-20 Average 95 stars, based on 1 article reviews
α 2 3 neuraminidase - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
90
|
Biosynth Carbosynth
pre adsorption Pre Adsorption, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Turkey+Red+Blood+Cells/pm29548604-78-5-12 Average 90 stars, based on 1 article reviews
pre adsorption - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
q5 high fidelity dna polymerase Q5 High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Q5+High-Fidelity+DNA+Polymerase/pm35106156-181-5-27 Average 99 stars, based on 1 article reviews
q5 high fidelity dna polymerase - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
85
|
Rockland Immunochemicals
turkey rbcs Turkey Rbcs, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Turkey+Blood+In+Sodium+Citrate/pmc03023136-196-10-12 Average 85 stars, based on 1 article reviews
turkey rbcs - by Bioz Stars,
2026-10
85/100 stars
|
Buy from Supplier |
93
|
Rockland Immunochemicals
turkey red blood cells Turkey Red Blood Cells, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Turkey+Red+Blood+Cells+10%25+Washed+Pooled+Cells/pmc03132197-53-24-28 Average 93 stars, based on 1 article reviews
turkey red blood cells - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
Innovative Research Inc
turkey red blood cells packed 5% Turkey Red Blood Cells Packed 5%, supplied by Innovative Research Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Turkey+Red+Blood+Cells+Packed+5%25/custom%40itkrbc5p15ml%4039477971 Average 93 stars, based on 1 article reviews
turkey red blood cells packed 5% - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
90
|
bioTRADING Benelux B.V
turkey red blood cells Turkey Red Blood Cells, supplied by bioTRADING Benelux B.V, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/turkey+red+blood+cells/pmc05485558-74-28-32 Average 90 stars, based on 1 article reviews
turkey red blood cells - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
anti–mouse trbc-pe Anti–Mouse Trbc Pe, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/tcr%CE%B2+antibody/pmc06597229-523-29-35 Average 90 stars, based on 1 article reviews
anti–mouse trbc-pe - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Lampire Biological
turkey red blood cells Turkey Red Blood Cells, supplied by Lampire Biological, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/blood+cells+red+turkey/bio_rxiv__64898__2026__05__07__722809-97-10-14 Average 86 stars, based on 1 article reviews
turkey red blood cells - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
90
|
Nippon Biotest Laboratories Inc
turkey red blood cells nippon biotest Turkey Red Blood Cells Nippon Biotest, supplied by Nippon Biotest Laboratories Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/guinea+pig+red+blood+cells/10__1128_slash_jvi__02004___17-251-17-21 Average 90 stars, based on 1 article reviews
turkey red blood cells nippon biotest - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
91
|
Cedarlane
turkey red blood cells Turkey Red Blood Cells, supplied by Cedarlane, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/Fresh+Turkey+Red+Blood+Cell+Suspension+(10%25)/pmc10223713-87-7-15 Average 91 stars, based on 1 article reviews
turkey red blood cells - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
primer: trbc reverse: gacagcggaagtggttgcgggggt  Primer: Trbc Reverse: Gacagcggaagtggttgcgggggt, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/turkey+red+blood+cells+rbc/trbc+reverse++gacagcggaagtggttgcgggggt/pmc07707104-135-0-5 Average 90 stars, based on 1 article reviews
primer: trbc reverse: gacagcggaagtggttgcgggggt - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: HLA-DR15 Molecules Jointly Shape an Autoreactive T Cell Repertoire in Multiple Sclerosis
doi: 10.1016/j.cell.2020.09.054
Figure Lengend Snippet:
Article Snippet:
Techniques: Purification, Recombinant, Produced, Staining, Lysis, Protease Inhibitor, Cell Isolation, Isolation, Enzyme-linked Immunosorbent Assay, Activation Assay, cDNA Synthesis, RNA Sequencing, Generated, Software